circad | circRNAs associated with diseases

hsa_circ_0005519
Gene	SNX13	Organism	Human
Genome Locus	chr7:17908029-17915413:-	Build	hg19
Disease	Asthma	ICD-10	Asthma (J45)
DBLink	Link to database	PMID	31148290
Experimental Method
Sample Type	Peripheral Blood Mononuclear Cells (PBMCs)	Comparison	Sixty"�five asthmatic patients and controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCTGGAGATTTCCAGAACAAGA Reverse CTCGTAAGTGTGTGCCAAAGTCA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Huang, Z, Cao, Y, Zhou, M, Qi, X, Fu, B, Mou, Y, Wu, G, Xie, J, Zhao, J, Xiong, W (2019). Hsa_circ_0005519 increases IL-13/IL-6 by regulating hsa-let-7a-5p in CD4+ T cells to affect asthma. Clin. Exp. Allergy, 49, 8:1116-1127.